rs7032460 chr9:78115264 A>T
- Sequence
ttccttgacctatatccacctata[A/T]tttgtccttgacctatatccaccc
- ASB in cell types
- LNCaP C4-2B (prostate carcinoma) 2588 (Lymphoblastoid Cell Lines) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP C4-2B (prostate carcinoma) | 4.46 | -4.45 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | -0.54 | 1.69 | 1.00 | |||
| foreskin keratinocyte | 1.03 | -4.08 | 2.67 |
Items per page:
1 – 3 of 3