rs7032795 chr9:114372665 T>C
- Sequence
gccccagtttcccaatctgccaaa[T/C]ggggaagcccaagtgtttgggtct
- ASB in cell types
- macrophages form periferal blood CTV-1 (Adult T acute lymphoblastic leukemia) hASC (derived adipocytes) monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 3.28 | -0.69 | 2.00 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.86 | 0.32 | 1.00 | |||
| hASC (derived adipocytes) | 2.15 | n/a | 2.00 | |||
| monocyte-derived dendritic cells | 2.07 | -4.53 | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hdl cholesterol, serum creatinine, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Adrenal_Gland, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Testis, Whole_Blood