rs703332 chr10:112633817 T>G
- Sequence
cttatactttgcagtttagttagt[T/G]aatttatttaaatagcattatcaa
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | 0.18 | 1.21 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, hypertension (early onset hypertension), mitral annular calcium, spine bone mineral density (bmd), systolic blood pressure (sbp), total cholesterol