rs7034056 chr9:128340498 A>T
- Sequence
ggcgccgcccgaagccgttgcgcg[A/T]gcagggcgggctggggccgagcgg
- ASB in cell types
- LNCaP C4-2B (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP C4-2B (prostate carcinoma) | -0.36 | 1.33 | 1.00 |
Items per page:
1 – 1 of 1