rs7034303 chr9:69131955 C>T
- Sequence
actcatggctatgatttattatgg[C/T]tcaaagatgcaaagcaaaataagc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.45 | n/a | 4.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, combined control dataset, gender differentiated, college completion, diastolic blood pressure (dbp), microalbuminuria, paternal transmission distortion, transmission distortion, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Testis, Whole_Blood