rs703978 chr10:79184390 C>G
- Sequence
catggctctgccatgcacttactg[C/G]gtggccttgggcaggtcacttaac
- ASB in cell types
- A549 (lung carcinoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.17 | 1.01 | 2.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.44 | 0.07 | 2.14 |
Items per page:
1 – 2 of 2