rs704010 chr10:79081391 T>C
- Sequence
cctgagacctgacctgaaaatagc[T/C]tagcccaggttgtaagacgtggca
- ASB in cell types
- Kasumi-1 (acute myeloblastic leukemia)
- ASB for transcription factors
- MTG8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MTG8_HUMAN | n/a | 2.29 | 2.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, bipolar disorder, birth weight, breast cancer, breast cancer (estrogen receptor negative breast cancer), hypertension (early onset hypertension), infant head circumference, lp-pla2 activity, maternal transmission distortion, parkinsons disease, transmission distortion
PheWAS abnormal reflex, acquired deformities of limbs, acute laryngitis and tracheitis, agorophobia, social phobia, and panic disorder, aneurysm of iliac artery, balanoposthitis, benign neoplasm of other parts of digestive system, bursitis, cataract, chronic kidney disease, stage i or ii, chronic lymphoid leukemia, cns infection and poliomyelitis, congenital anomalies of face and neck, congenital anomalies of urinary system, cystic kidney disease, decubitus ulcer, diabetic retinopathy, diseases of pancreas, diseases of pulp and periapical tissues, disorders of adrenal glands, disorders of muscle, ligament, and fascia, displacement of intervertebral disc, diverticulitis, effects of radiation nos, elevated prostate specific antigen, endometriosis, enthesopathy, esophageal cancer, fasciitis, gastrointestinal malfunction arising from mental factors, generalized anxiety disorder, genitourinary congenital anomalies, gram positive septicemia, heart valve disorders, heart valve replaced, intervertebral disc disorders, intestinal malabsorption nos, intracranial hemorrhage (injury), iron deficiency anemias, iron deficiency anemias nos, lymphoid leukemia, major depressive disorder, megaloblastic anemia, nonrheumatic aortic valve disorders, nonspecific findings on examination of blood, other cells and casts in urine, other congenital anomalies, other diseases of lung, other disorders of soft tissues, other immunological findings, other rheumatic heart disease, other specified disorders of breast, other specified intestinal malabsorption, other specified nonpsychotic and/or transient mental disorders, pain in limb, paranoid disorders, parkinsons disease, pathologic fracture, pathologic fracture of vertebrae, periapical abscess, peripheral enthesopathies, pernicious anemia, phlebitis and thrombophlebitis, phlebitis and thrombophlebitis of lower extremities, poisoning by analgesics, antipyretics, and antirheumatics, raynauds syndrome, second degree av block, sinoatrial node dysfunction, swelling, mass, or lump in head and neck, symptoms involving nervous and musculoskeletal systems, toxic erythema, type 1 diabetic retinopathy, type 2 diabetic retinopathy, ulcerative stomatitis & mucositis, urethritis and urethral syndrome, uterine leiomyoma, vascular insufficiency of intestine, ventral hernia, wheezing and painful respiration