rs704084 chr12:89384460 T>C
- Sequence
cagcccagcagtttggaaatgtta[T/C]gaattcaggggaggcaggaaatgt
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) hTERT-HME1(Telomerase immortalized cell line)
- ASB for transcription factors
- TF65_HUMAN BRCA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.70 | -0.39 | 4.00 | n/a | No Hit | |||
| BRCA2_HUMAN | -0.50 | 1.66 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, birth weight, body mass index (bmi), college completion, diastolic blood pressure (dbp), hdl cholesterol change with statins, maternal transmission distortion, obesity with early age of onset (age >2), prop taste detection threshold, systolic blood pressure (sbp), total cholesterol