rs704633 chr1:201791853 A>G
- Sequence
agcactttttcccactcttggggg[A/G]cccataagaattgtaacataaaca
- ASB in cell types
- EA.hy 926 (human umbilical vein endothelial cell line) HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| EA.hy 926 (human umbilical vein endothelial cell line) | n/a | 1.36 | 2.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | -1.62 | 2.55 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, adiponectin levels, body mass index (bmi), cystatin c in serum, triglycerides change with statins, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid