rs705458 chr10:3569223 A>G
- Sequence
gaacatgacgttcgaggtgaaggt[A/G]agaaatatcacattacattggaac
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 0.28 | 2.94 | 1.67 | -1.12 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP diastolic blood pressure (dbp), ldl cholesterol change with statins, systolic blood pressure (sbp), years of education