rs706981 chr6:119130167 A>G
- Sequence
tatttttccagttgaacaacttca[A/G]ctgttaagcagaatccacataatt
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.14 | 1.15 | 2.00 | |||
| K562 (myelogenous leukemia) | 0.62 | 0.06 | 1.99 | |||
| VCaP (prostate carcinoma) | -0.60 | 1.48 | 2.00 |
Items per page:
1 – 3 of 3