rs707075 chr2:154447658 T>C
- Sequence
gttagtggaggaaacaattgagct[T/C]agaagtcttggaacaaggctagaa
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | n/a | 3.65 | 2.00 | 3.33 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol, maternal transmission distortion, obesity with early age of onset (age >2), tetrology of fallot, total cholesterol, transmission distortion