rs707911 chr6:31271800 A>C
- Sequence
gcgtgtcgtccacgtagcccactg[A/C]gatgaagcggggctctccgcggcc
- ASB in cell types
- HCT-116 (colon carcinoma) 22RV1 (prostate carcinoma) upper lobe of left lung pancreas
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.74 | -0.15 | 1.32 | n/a | No Hit | |||
| RAD21_HUMAN | 2.09 | -0.93 | 1.67 | n/a | n/a |
Items per page:
1 – 2 of 2