rs709129 chr3:192957842 G>A
- Sequence
caagatgaggaagaaacagttacc[G/A]tcatttccccctcaaaccaaaggg
- ASB in cell types
- MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | -0.77 | 2.23 | 2.19 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Nerve_Tibial, Thyroid