rs712219 chr6:151657304 T>C
- Sequence
aaaagggaaattaattaaactaga[T/C]aacttttatgggtactaaccatta
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -0.41 | 1.52 | 1.75 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP breast size (bra cup size in women), fasting insulin, hdl cholesterol, hip bone mineral density (bmd), hip bone mineral density (bmd) (females), hip bone mineral density (bmd) (males), low trauma fracture, rheumatoid arthritis, spine bone mineral density (bmd), spine bone mineral density (bmd) (females), spine bone mineral density (bmd) (males)