rs712328 chr14:36771320 G>T
- Sequence
acaaaataaatcactgatttaatc[G/T]tatttttgcaattgtcatttttgg
- ASB in cell types
- 22RV1 (prostate carcinoma) breast tumor ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.74 | n/a | 2.00 | |||
| breast tumor | 1.82 | -0.55 | 2.00 | |||
| ZR-75-1 (invasive ductal carcinoma) | 0.21 | 1.18 | 2.00 |
Items per page:
1 – 3 of 3