rs712959 chr22:19171502 C>T
- Sequence
aagatcaggggctggtggcagtga[C/T]cgcgaggggcctccaagcagccca
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.91 | 0.22 | 1.99 | |||
| K562 (myelogenous leukemia) | 0.91 | 0.79 | 4.18 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.72 | 0.94 | 1.02 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood