rs713449 chr14:60562366 C>G
- Sequence
ccacctcgtgtgcaaaagcgtttt[C/G]ttttgtttcctcgagaaccactag
- ASB in cell types
- HMEC (human mammary epithelial cells) erythroid cells gastroesophageal sphincter hASC (preadipocytes)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 2.45 | 0.19 | 1.07 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, infant head circumference, obesity with early age of onset (age >2), rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Sun_Exposed_Lower_leg, Thyroid