rs713939 chr22:37330619 T>C
- Sequence
ctcattccccttgagtctgcagct[T/C]gggcaatcaatcggtcgccatgga
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) epithelial cell of prostate GM19239 (male B-cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- CTCF_HUMAN ZN660_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.79 | 0.43 | 1.47 | n/a | No Hit | |||
| ZN660_HUMAN | n/a | 0.80 | 2.00 | -4.15 | Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP acute lung injury following major trauma, advanced age-related macular degeneration, hdl cholesterol, obesity with early age of onset (age >2)