rs715706 chr4:105594871 C>T
- Sequence
ttttgcaaagaaggcaaacgttat[C/T]cacatcagttagtgttgaaacatt
- ASB in cell types
- LNCaP (prostate carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -0.01 | 1.35 | 1.62 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.83 | 0.59 | 1.12 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, irritible bowel syndrome, lung function, forced expiratory volume in 1 second (fev1), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), schizophrenia, total cholesterol change with statins
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Pancreas