rs716390 chr15:32843394 A>G
- Sequence
atgccacagtcatgactacaaact[A/G]gaaaccaatgccagaggaagctta
- ASB in cell types
- GM23248 U87 (glioblastoma)
- ASB for transcription factors
- BRD4_HUMAN EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | -3.01 | 2.69 | 1.00 | n/a | n/a | |||
| EZH2_HUMAN | -1.95 | 2.39 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, ldl cholesterol change with statins, total cholesterol change with statins