rs718049 chr20:50580062 C>T
- Sequence
cttccgcatccttggggaacaggg[C/T]gcgtggaccacagccactccactc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) ID00014 (lymphoblastoid cell, DiGeorge syndrome) GM12878 (female B-cells lymphoblastoid cell line) MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.50 | 1.02 | 3.68 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | -0.50 | 1.58 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.36 | 0.85 | 1.19 | |||
| MCF7L-P(immortalized breast epithelial cell line) | n/a | 1.01 | 4.00 | |||
| spleen | 1.59 | -0.70 | 1.00 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Hypothalamus, Brain_Spinal_cord_cervical_c-1, Nerve_Tibial, Testis, Whole_Blood