rs718050 chr20:50580393 A>G
- Sequence
gttaacaaccattattgagtacct[A/G]ttgatatgtgtggtgtactgagtt
- ASB in cell types
- RWPE1 (prostate epithelial cells) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RWPE1 (prostate epithelial cells) | 1.41 | -1.41 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | -0.57 | 1.05 | 1.00 |
Items per page:
1 – 2 of 2