rs718053 chr20:50580065 G>A
- Sequence
ccgcatccttggggaacagggcgc[G/A]tggaccacagccactccactcctg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) ID00014 (lymphoblastoid cell, DiGeorge syndrome) MCF7L-P(immortalized breast epithelial cell line) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.53 | 1.19 | 3.68 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | -0.58 | 1.83 | 1.00 | |||
| MCF7L-P(immortalized breast epithelial cell line) | n/a | 1.21 | 4.00 | |||
| T47D (invasive ductal carcinoma) | 0.12 | 0.99 | 1.93 | |||
| spleen | 1.59 | -0.70 | 1.00 |
Items per page:
1 – 5 of 5