rs718820 chr4:107130343 T>C
- Sequence
tcatgattacactgaaaggaattg[T/C]tctggaggaagtgatacatgttcc
- ASB in cell types
- NOMO-1 (acute monocytic leukemia) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- ZF64B_HUMAN E2F8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZF64B_HUMAN | -2.12 | 2.04 | 1.25 | n/a | No Hit | |||
| E2F8_HUMAN | -0.10 | 1.46 | 1.25 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, obesity with early age of onset (age >2)