rs7194418 chr16:81205249 C>T
- Sequence
gaacaatgtcaatccctagatttg[C/T]cagaaggtggcgctcagctaacca
- ASB in cell types
- 22RV1 (prostate carcinoma) T cells from peripheral blood GM02610 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 0.86 | -0.14 | 1.33 | |||
| T cells from peripheral blood | 2.33 | -1.93 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 0.72 | -0.48 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.72 | 0.42 | 1.14 | |||
| tibial nerve | 1.80 | -1.50 | 1.00 |
Items per page:
1 – 5 of 5