rs719470 chr17:14303045 T>C
- Sequence
aatcactacctctgcccactgctt[T/C]ccgcagctgctggtctttggggtg
- ASB in cell types
- liver bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 1.13 | -0.18 | 1.22 | |||
| bipolar neuron | -0.25 | 1.89 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, obesity with early age of onset (age >2), rheumatoid arthritis, schizophrenia
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Whole_Blood