rs7198588 chr16:77236247 C>A
- Sequence
tgacgccatgcaatatgttcaggg[C/A]acaccagagggcgctacggcttcg
- ASB in cell types
- HepG2 (hepatoblastoma) 2588 (Lymphoblastoid Cell Lines) primary human epidermal keratinocytes CD14+ monocytes
- ASB for transcription factors
- SMAD4_HUMAN STAT1_HUMAN A4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMAD4_HUMAN | 3.37 | -0.40 | 2.00 | n/a | No Hit | |||
| STAT1_HUMAN | 1.78 | -4.45 | 2.00 | 3.61 | Discordant | |||
| A4_HUMAN | 2.04 | -1.84 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), late onset alzheimers disease, waist hip ratio