rs721066 chr5:118792230 A>G
- Sequence
tactactagtgccaccttctggtc[A/G]tctgattctatggcaggcctcctg
- ASB in cell types
- HEK293 (embryonic kidney) epithelial cell of proximal tubule CD34+ hematopoietic stem cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.09 | 1.15 | 1.75 | |||
| epithelial cell of proximal tubule | 2.35 | -1.83 | 1.00 | |||
| CD34+ hematopoietic stem cells | 2.37 | -4.60 | 2.00 |
Items per page:
1 – 3 of 3