rs721183 chr8:23528321 A>G
- Sequence
tcaaacccaaagaaaatttcctgg[A/G]ggtgcctactcagaggggctccct
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- PRD10_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRD10_HUMAN | n/a | 4.20 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, body mass index (bmi), diastolic blood pressure (dbp), height, ldl cholesterol, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Thyroid, Whole_Blood