rs721302 chr8:4787146 C>T
- Sequence
ttagagggaaactatccgcctata[C/T]ccctccgggttcggccgctgtagc
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) LNCaP (prostate carcinoma) hepatocytes
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.45 | 0.58 | 1.52 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), cystatin c in serum, plasma brain natriuretic peptide (bnp), schizophrenia