rs721411 chr17:41492692 C>T
- Sequence
agagactgaaactgctattagtac[C/T]catatagtcagaaccccagtccaa
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 2.62 | -4.84 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, diastolic blood pressure (dbp), hypertension (early onset hypertension), ldl cholesterol change with statins, microalbuminuria, obesity with early age of onset (age >2), premature ovarian failure, rheumatoid arthritis, systolic blood pressure (sbp), total cholesterol change with statins, transmission distortion, triglycerides change with statins