rs723576 chr13:95551837 G>A
- Sequence
ttgagacagcaatgaagggatgaa[G/A]gaatgaatgagtttatatttcaat
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | n/a | 1.83 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, cystatin c in serum, primary rhegmatogenous retinal detachment, prop taste detection threshold, pulse pressure, rheumatoid arthritis, schizophrenia
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach