rs724915 chr6:17885120 G>A
- Sequence
tcaaagttgtgaagattcataaaa[G/A]aaaaaaaggaagagttaaacttca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- IKZF1_HUMAN NFAC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 2.30 | -1.02 | 1.25 | n/a | n/a | |||
| NFAC3_HUMAN | 2.39 | -2.06 | 1.00 | -4.36 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), fasting insulin, hdl cholesterol change with statins, homa-b, homa-ir, obesity (body mass index (bmi)), resistance to kuru in aged women despite likely exposure, total cholesterol, triglycerides, triglycerides change with statins