rs725340 chr9:114487594 G>A
- Sequence
ttttttgctagcaccatcacctgc[G/A]atgaacatccttgtatgtgccatc
- ASB in cell types
- prostate gland GM12878 (female B-cells lymphoblastoid cell line) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| prostate gland | 2.38 | -2.07 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.94 | n/a | 1.00 | |||
| T47D (invasive ductal carcinoma) | 0.89 | 1.13 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, microalbuminuria, parkinsons disease, urinary albumin-to-creatinine ratio