rs725386 chr4:16111635 T>C
- Sequence
aacagcatgtcctagatgttttcg[T/C]gacatgacaagtatgttatactca
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- TEAD3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD3_HUMAN | 1.81 | -3.20 | 1.50 | -0.58 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
