rs7259723 chr19:17555827 C>T
- Sequence
cccgccgggcgccgacgcctactt[C/T]cccgaggagcgctggagcccggag
- ASB in cell types
- MDA-MB-231 (breast adenocarcinoma)
- ASB for transcription factors
- BRD2_HUMAN ZN528_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD2_HUMAN | 1.68 | 0.42 | 1.71 | n/a | n/a | |||
| ZN528_HUMAN | 2.82 | -5.34 | 2.00 | -2.49 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood