rs726418 chr17:72466267 G>A
- Sequence
cttaagcaatgctctgtttctaca[G/A]gcagctcccacttgtggaaaggca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM19238 (female B-cells lymphoblastoid cell lines) GM02630 (Fanconi anemi) GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.36 | 1.53 | 1.00 | n/a | n/a | |||
| IKZF2_HUMAN | -1.00 | 1.16 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, spine bone mineral density (bmd), stabilized warfarin dose, tetrology of fallot, triglycerides