rs726952 chr1:214808895 A>G
- Sequence
gctgaacacagattttggagactg[A/G]aggtgggaaagaatggaactgaga
- ASB in cell types
- LNCaP (prostate carcinoma) foreskin keratinocyte 2588 (Lymphoblastoid Cell Lines) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -1.53 | 2.09 | 1.00 | |||
| foreskin keratinocyte | 0.93 | -3.27 | 2.50 | |||
| 2588 (Lymphoblastoid Cell Lines) | -0.68 | 1.76 | 1.00 | |||
| bipolar neuron | -1.61 | 2.18 | 1.00 |
Items per page:
1 – 4 of 4