rs727088 chr18:69863203 G>A
- Sequence
tccctcccaaatttctaccctacc[G/A]tcctatgccaccactttcaactgt
- ASB for transcription factors
- ATF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF2_HUMAN | 2.15 | -0.25 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, acute lung injury following major trauma, aortic valve calcium, fasting blood glucose, inflammatory bowel disease, irritible bowel syndrome, ldl cholesterol change with statins, rheumatoid arthritis, spine bone mineral density (bmd), triglycerides