rs72715630 chr14:101731357 G>A
- Sequence
aatctcccctgcgtggtgacttag[G/A]ggaggagccggaagagagcagtgc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) macrophages GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CEBPB_HUMAN ELF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 2.37 | -0.10 | 1.50 | n/a | No Hit | |||
| ELF1_HUMAN | 1.35 | 0.32 | 1.30 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Lung, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood