rs72720597 chr8:125334583 G>A
- Sequence
ttcccacctccccctgctggaggg[G/A]aattgtttttctcacgggttggaa
- ASB in cell types
- RH4 (alveolar rhabdomyosarcoma) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RH4 (alveolar rhabdomyosarcoma) | -1.94 | 2.89 | 2.00 | |||
| 22RV1 (prostate carcinoma) | 1.86 | -0.91 | 1.50 |
Items per page:
1 – 2 of 2