rs72724341 chr8:134905603 G>A
- Sequence
tcccaccaaaaatgaggatatcct[G/A]tgcttcctatgagcctgtgatgat
- ASB in cell types
- A549 (lung carcinoma) HeLa Kyoto (cervical adenocarcinoma) KMS-11 (Plasma cell myeloma) upper lobe of left lung
- ASB for transcription factors
- PMEPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PMEPA_HUMAN | 2.84 | -5.17 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1