rs72724749 chr4:139177591 C>T
- Sequence
tgtccggctccttgcccagggctc[C/T]ccgatctcgctctccactccagcc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.82 | 0.16 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 2.15 | -1.95 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid