rs72725003 chr9:35203715 C>T
- Sequence
tgtggcctggctgcttctaacagc[C/T]tgcattcatatgcatgagcaagga
- ASB in cell types
- WA01 (H1, human embryonic stem cells)
- ASB for transcription factors
- TIF1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TIF1B_HUMAN | -0.29 | 1.48 | 1.20 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid