rs72726024 chr9:38020827 G>T
- Sequence
ccctgaaagtgacggggtgggggg[G/T]tggcccaacagggatcctagcccc
- ASB in cell types
- macrophages
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 2.66 | -1.87 | 2.00 | -2.51 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
