rs72729532 chr8:133075080 G>A
- Sequence
ggaaggcacagggcttgcagaagg[G/A]caggttcctgttttcagtaaccac
- ASB in cell types
- naive IgD+ B cells MDM(monocyte derived macrophages) thoracic aorta
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.17 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1