rs72730558 chr5:34742966 G>A
- Sequence
atgagccactgtgcccagcctgct[G/A]tttttagtgtctatacccaaagca
- ASB for transcription factors
- ZIC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZIC2_HUMAN | 1.90 | n/a | 3.00 | -3.73 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
