rs72731820 chr4:146522419 G>C
- Sequence
acgctagcgctgacgtatgcgcgg[G/C]ggggaggggaggccactctggatc
- ASB in cell types
- K562 (myelogenous leukemia) breast tumor A549 (lung carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.37 | 0.92 | 2.01 | |||
| breast tumor | 2.05 | -1.14 | 2.00 | |||
| A549 (lung carcinoma) | 1.22 | 0.07 | 1.15 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.81 | -3.60 | 1.50 | |||
| 22RV1 (prostate carcinoma) | 2.21 | -0.07 | 1.60 |
Items per page:
1 – 5 of 5