rs72734895 chr15:50110675 T>C
- Sequence
aaaactgcctcaaagtagaggaaa[T/C]ggaaaagggaaagctgctagatga
- ASB in cell types
- MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.25 | n/a | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Thyroid